Życie minimalne

                                                               Craig Venter

Dr Craig Venter od dawna zapowiadał, że planuje stworzyć w laboratorium życie z materii nieożywionej. Gdy 20 maja 2010 roku przedstawił swoje najnowsze osiągnięcie, [1] pojawiły się komentarze, że dokonał czegoś, co religia dotąd przypisywała samemu Bogu: naukowcom udało się stworzyć pierwszą żywą komórkę kontrolowaną przez sztuczny genom, [2] albo że stworzyli oni pierwszą na świecie syntetyczną formę życia. [3] Arthur Caplan, profesor filozofii i bioetyki na Uniwersytecie Pennsylvanii, tak ocenił ten wyczyn:

Venter i jego koledzy wykazali, że można tak manipulować elementami świata materialnego, by utworzyć coś, co uważamy za życie. W ten sposób zakończyli oni trwającą od tysięcy lat debatę na temat natury życia. Ich osiągnięcie podważa podstawowe przekonanie na temat natury życia i prawdopodobnie okaże się równie doniosłe dla rozumienia nas samych i naszego miejsca we Wszechświecie, co odkrycia Galileusza, Kopernika, Darwina i Einsteina. [4]

Czy rzeczywiście? Na czym naprawdę polega to osiągnięcie? Zespół Ventera zastąpił naturalny DNA w komórce bakteryjnej przez DNA, jaki sztucznie zsyntetyzowano. Najpierw określono kolejność nukleotydów w DNA jednej z najprostszych bakterii świata. Później wykorzystano tę wiedzę do zsyntetyzowania kopii tego DNA z podjednostek zakupionych w firmie, dostarczającej materiał biologiczny. Następnie wstawiono tę syntetyczną kopię DNA do żywej komórki bakteryjnej, z której wcześniej usunięto naturalny DNA. Komórka ta zaczęła od tej chwili funkcjonować zgodnie z nowym DNA.

Komentator naukowy New York Timesa, Nicholas Wade, zauważył jednak, [5] że czegoś podobnego dokonał Eckard Wimmer ze współpracownikami w 2002 roku, syntetyzując RNA poliowirusa. Zespół Wimmera wykorzystał ten syntetyczny RNA do utworzenia funkcjonalnych poliowirusów. [6] Wirusami polio zarażono następnie mysz, w rezultacie czego doprowadzono ją do śmierci. Różnica między oboma eksperymentami polega głównie na tym, że genom wirusa polio ma tylko 7500 jednostek długości, a genom bakterii jest ponad sto razy dłuższy.

Wirus to tylko kwas nukleinowy (RNA lub DNA) w białkowej powłoce zewnętrznej (niektóre wirusy posiadają też inne składniki, ale to nieistotne dla naszych rozważań). Wirusowy kwas nukleinowy ani białkowa otoczka nie są w stanie utworzyć samodzielnie jednostek potomnych. Mogą to robić wykorzystując materiał komórkowy, dopiero po wniknięciu do żywej komórki (w przypadku eksperymentu Wimmera był to precyzyjnie przygotowany ekstrakt z żywych komórek), ponieważ dopiero żywa komórka posiada złożony mechanizm niezbędny do powielenia RNA lub DNA i utworzenia białkowej powłoki. Po wniknięciu części nukleinowej wirusa do komórki następują (po okresie utajonego zakażenia) zjawiska genetyczno-rekombinacyjne i przestawienie metabolizmu komórki na produkcję nowych cząstek wirusa, a w końcu uwalnianie cząstek potomnych.

„To, co udało się osiągnąć Venterowi, to zsyntetyzowanie dużych cząsteczek DNA. To bardzo trudne technicznie, ale nie oznacza żadnego stworzenia życia.”

Ale wirusy, choć zachowują się podobnie jak organizmy żywe, nie zaliczają się do nich. Umieszcza się je na tzw. pograniczu życia, między materią martwą i żywą. Sam kwas nukleinowy, RNA czy DNA, jest niezbędnym składnikiem życia, ale żywe są dopiero komórki. Życie, jakie znamy, pochodzi zawsze z tego, co żywe. Venter i jego zespół nie udowodnili niczego innego. Nie stworzyli nowego życia, ponieważ musieli je w swoim eksperymencie wykorzystać. Utworzenie życia z materii nieożywionej wymaga czegoś więcej niż zsyntetyzowania DNA.

Zwróciła na to uwagę genetyk z Uniwersytetu Warszawskiego, prof. Ewa Bartnik. – „Eksperyment Amerykanina Craiga Ventera, polegający na umieszczeniu syntetycznego DNA w komórce bakterii, to nie jest stworzenie sztucznego organizmu. Potrzebne było jednak puste „ciało” komórki, które podjęło swoje funkcje po wprowadzeniu obcego materiału genetycznego. To można porównać do przeprogramowania komputera, które nie oznacza przecież budowy komputera od podstaw” – zaznaczyła. – „To, co udało się osiągnąć Venterowi, to zsyntetyzowanie dużych cząsteczek DNA. To bardzo trudne technicznie, ale nie oznacza żadnego stworzenia życia. Samo DNA jest tak samo martwe jak kamień. Potrzebna jest komórka, aby mogło sterować jej życiem” – podkreśliła Bartnik. [7]

Analogia komputerowa, użyta przez prof. Bartnik, każe uznać DNA za software życia. Tej samej analogii użył kilka lat wcześniej Paul Davies, antykreacjonistyczny, a nawet antychrześcijański ewolucjonista. Davies nazwał żywą komórkę „układem przetwarzania i powielania informacji o zdumiewającej złożoności”. [8] Wg Daviesa DNA nie jest cząsteczką, która daje życie, ale genetycznym bankiem danych, przekazującym informacje przy użyciu pewnego matematycznego kodu. Większość funkcji żywej komórki najlepiej jest opisywać nie przy pomocy jej składników – hardware’u – ale przy pomocy informacji, czyli software’u. Ale wówczas powstaje problem, jak życie mogło powstać z nieożywionych składników chemicznych: „Jak przyroda utworzyła pierwszy na świecie cyfrowy procesor – pierwszą żywą komórkę – ze ślepego chaosu poruszających się chaotycznie cząsteczek? Jak molekularny hardware zapisał swój software?”. Problem ten jest znaczny, gdyż – jak zauważył pół wieku temu chemik i filozof Michael Polanyi – treść kodowana przez DNA nie ma nic wspólnego z własnościami fizykochemicznymi tej makrocząsteczki, tylko z porządkiem występowania jej składników, podobnie jak treść wydrukowanej strony w książce nie ma nic wspólnego z własnościami fizykochemicznymi papieru i farby drukarskiej. [9]

Właściwe proporcje dla osiągnięcia Ventera znajdziemy w komentarzach fachowców. Laureat Nagrody Nobla David Baltimore uznał, że Venter znacznie przecenił wagę swego sukcesu, który był raczej technicznym wyczynem niż naukowym przełomem. W opinii Baltimore’a Venter nie stworzył życia, on tylko naśladował jego funkcjonowanie. [10] Podobnie uważa Jim Collins, profesor inżynierii biomedycznej Uniwersytetu Bostońskiego. Jego zdaniem sukces Ventera należy do dziedziny manipulowania już istniejącymi organizmami, a nie stwarzania życia od zera. Według Collinsa uczeni nie posiadają jeszcze wystarczającej wiedzy do stworzenia życia i stawiają sobie znacznie skromniejsze cele. [11]

Jeśli uwzględnimy fakt, że Venter modelował swój software według wiedzy o DNA najprostszego samoreplikującego się organizmu; że najpierw zidentyfikował sekwencję nukleotydów w DNA bakterii Mycoplasma, a potem wykorzystał tę wiedzę do zsyntetyzowania sztucznego DNA – to zrozumiemy lepiej, co David Baltimore miał na myśli, mówiąc, że Venter nie stworzył, a jedynie naśladował funkcjonowanie życia. Jeszcze lepiej to zrozumiemy, jeśli dowiemy się, że Venter korzystał z 50-80-literowych łańcuchów DNA, dalece przewyższających to, co może wyprodukować tzw. pierwotna zupa, że korzystał wyłącznie z prawoskrętnych łańcuchów DNA, podczas gdy pierwotna zupa tworzyłaby mieszankę mniej więcej pół na pół łańcuchów prawo- i lewoskrętnych, oraz że aby łączyć mniejsze łańcuchy DNA w większe, użył białek znajdowanych w drożdżach, czyli i tu wykorzystał istniejące życie.

Zespół Craiga Ventera ma na swym koncie olbrzymie naukowe osiągnięcie, będące wynikiem wielu lat pracy i dużej pomysłowości. Ale osiągnięciu temu jest daleko do tego, co bez pomocy ze strony jakiegoś inteligentnego czynnika rzekomo osiągnęła ślepa przyroda kilka miliardów lat temu.

m.cuber@wp.pl,
Przypisy:
[1] Daniel G. Gibson et. al., „Creation of a Bacterial Cell Controlled by a Chemically Synthesized Genome”, Science 2 July 2010, Vol. 329. no. 5987, pp. 52-56, pierwotnie opublikowany w Science Express 20 maja 2010, http://tiny.pl/h97lx.
[2] „Pierwsza żywa komórka sterowana sztucznym genomem”, Nauka w Polsce. Serwis PAP poświęcony polskiej nauce, http://tiny.pl/h97jv.
[3] Ian Sample, „Craig Venter creates synthetic life form”, The Guardian 20 May 2010, http://tiny.pl/ht92n.
[4] „Sizing up the ‚synthetic cell'”, opublikowane online 20 maja 2010, http://tiny.pl/h97pb.
[5] Nicholas Wade, „Researchers Say They Created a Synthetic Cell”, New York Times May 20, 2010, http://tiny.pl/h97p3.
[6] http://tiny.pl/h97lm.
[7] „Prof. Bartnik: Craig Venter nie stworzył sztucznego życia”, Nauka w Polsce. Serwis PAP poświęcony polskiej nauce, http://tiny.pl/h97j4.
[8] Paul Davies, „How we could create life – The key to existence will be found not in primordial sludge, but in the nanotechnology of the living cell”, The Guardian, 11 December 2002, http://tiny.pl/h97lv.
[9] Por. Michael Polanyi, „Life’s irreducible structure”, Science 21 June, 1968, vol. 160, no. 3834, s. 1308-1312.
[10] Cyt. za: Wade, „Researchers Say They Created…”.
[11] Por. „Sizing up the ‚synthetic cell'”… (Jonathan Sarfati, „Was life really created in a test tube? And does it disprove biblical creation?”, Creation Ministries International http://tiny.pl/h97s6; Jonathan Wells, „Has Craig Venter Produced Artificial Life?”, Evolution News & Views http://tiny.pl/h97s4; Heathem Zeiger, „Creating Life in the Lab”, Probe Ministries http://tiny.pl/h97sn)

Marta Cuberbiller

ŹRÓDŁO:

http://podprad.org/archiwum-2.php?idg=1491&tyt=PRZEGL%C4%84D%20PRASY%20KREACJONISTYCZNEJ%20-%20NAUKOWA%20MITOLOGIA%20ZAST%C4%98PUJE%20RELIGI%C4%98?

lINK  DO  KEKSTU  POKREWNEGO:

https://bioslawek.wordpress.com/2012/04/30/zwodniczy-argument-bertranda-russela-czyli-o-liczeniu-prawdopodobienstwa-zajscia-danego-zdarzenia-juz-po-fakcie-jego-zajscia-i-przenoszeniu-tej-argumentacji-na-grunt-zagadnienia-zwioazanego-z-pochodz/

‚Zwodniczy argument Bertranda Russela, czyli o liczeniu prawdopodobieństwa zajścia danego zdarzenia już po fakcie jego zajścia i przenoszeniu tej argumentacji na grunt zagadnienia związanego z pochodzeniem żywej komórki’

12 responses to “Życie minimalne

  1. „Jakie jest prawdopodobieństwo połączenia się odpowiednich aminokwasów w cząsteczkę białka prostego? Wyobraźmy sobie duży kopiec nasion czerwonej i białej fasoli. Oba rodzaje są w równych ilościach i starannie wymieszane. Poza tym należą one do ponad 100 różnych odmian fasoli. Co by się nabrało na szufelkę zanurzoną w tym kopcu? Gdyby chcieć naczerpać tylko tych nasion, które wyobrażają podstawowe składniki protein, to na szufelce musiałyby się znaleźć same czerwone — ani jednego białego! Co więcej, na szufelce musiałoby być 20 odmian nasion czerwonej fasoli, i do tego każde z nich na ściśle określonym miejscu. Gdyby — przenosząc to na grunt protein — choćby jeden z tych warunków nie został spełniony, odbiłoby się to ujemnie na prawidłowym funkcjonowaniu danej proteiny. Czy mieszanie do woli w tym hipotetycznym kopcu i nabieranie na szufelkę, pozwoliłoby kiedykolwiek uzyskać właściwą kombinację? Nie. Dlaczego więc miałoby się to udać w hipotetycznym bulionie pierwotnym?”
    Może przeanalizujmy to z innej strony, ale jeszcze dla uwydatnienia problemu zacytuję Freda Hyle’a: Fred Hoyle
    „Wielkim problemem biologii nie jest sam oczywisty fakt, że białko to łańcuch aminokwasów połączonych ze sobą w określony sposób, lecz raczej okoliczność, że ich kolejność nadaje temu łańcuchowi szczególne właściwości (…) Gdyby aminokwasy zostały połączone przypadkowo, rezultatem byłaby ogromna liczba kombinacji nieprzydatnych żywej komórce. Kiedy się rozważy, że typowy enzym jest łańcuchem złożonym z jakichś 200 ogniw i że dla każdego ogniwa istnieje 20 możliwości, to łatwo zauważyć, iż liczba bezużytecznych kombinacji jest kolosalna, większa od liczby atomów we wszystkich galaktykach dostrzegalnych przez największe teleskopy. Tak wygląda sytuacja w wypadku jednego enzymu, a przecież jest ich przeszło 2000 i służą na ogół bardzo różnym celom. Jakim więc sposobem wszystkie one zaistniały?”
    Fred Hoyle wypowiedział powyższe słowa dawno temu. Teraz wiadomo, że przeciętne białko (łańcuch polipeptydowy) w komórce składa się z 300 ogniw, to znaczy z aminokwasów lewoskrętnych. Jak wiadomo w przyrodzie istnieje jakieś 100 rodzajów aminokwasów. 50% to aminokwasy prawoskrętne i 50%, to lewoskrętne. W organizmach żywych w skład budowy białek wchodzą tylko aminokwasy lewoskrętne i w dodatku tylko 20 rodzajów z tych 50% aminokwasów lewoskrętnych. Weźmy pod uwagę oszacowanie Freda Hoyl’a. Badał on możliwość abiotycznej syntezy (samoistnego powstania życia) i założył, że pierwsze białka składały się nie nie z 300, lecz z 200 aminokwasów. Teraz wyobraźmy sobie maszynę do losowania w totolotka. Wrzućmy do niej 100 piłek (które ilustrują wszystkie rodzaje aminokwasów). 50 czerwonych (co ma ilustrować prawoskrętne aminokwasy) i 50 białych (co ma ilustrować lewoskrętne aminokwasy) z czego 20 z tych 50 białych piłek posiada namalowane numery od 1 do 20 (białe piłki z namalowanymi numerami mają obrazować te 20 z 50 rodzajów aminokwasów lewoskrętnych, które są niezbędne do powstania prawidłowych białek w żywych organizmach). Teraz zacznijmy losowanie. Jakie jest prawdopodobieństwo, że za pierwszym razem wylosujemy te 20 białych i ponumerowanych piłek w kolejności od 1 do 20? Żeby jeszcze bardziej zbliżyć się do rzeczywistości związanej z problemem samorzutnego postania życia, musimy uszczegółowić nasz model. Pamiętajmy, że hipotetyczne, najprostsze białka w protobioncie (pierwszym żywym organizmie) Freda Hoyle’a składały się z 200 aminokwasów, nie z 20, a w naszym losowaniu mieliśmy za zadanie wylosować tylko 20 piłeczek obrazujących aminokwasy w ściśle uporządkowanej kolejności (sekwencji) od 1 do 20. Więc żeby odwzorować rzeczywistość, takie losowanie kulek, z liczbami w kolejności od 1 do 20, musiałoby się udać 10 razy z rzędu! Czy jest możliwe, aby w 10 losowaniach wylosować 10 razy pod rząd piłeczki w kolejności od 1 do 20? A pamiętajmy, że do funkcjonowania najprostszego organizmu minimalnego potrzeba przynajmniej 2000 białek złożonych, w założeniu, przynajmniej z 200 aminokwasów każde! Czyli należałoby przeprowadzić więcej takich losowań. Należałoby 2000 razy z rzędu wylosować piłeczki w kolejności od 1 do 200 ! Gołe liczby mało kogo przekonują i dopiero takie przejrzyste argumenty mogą dotrzeć do pewnych nierozsądnych umysłów, które wyćwiczyły się w akceptowaniu różnych naiwnych bajeczek, jak ta o przypadkowym powstaniu życia z takich monomerów, jak pojedyncze zasady azotowe, nukleotydy i aminokwasy. Ewolucjoniści już dawno temu zdali sobie sprawę, że przy obecnym stanie wiedzy nie da się utrzymać na rynku idei naukowych modelu Oparina, który usiłowano podeprzeć eksperymentem Stanleya Millera. A ponieważ doszli do wniosku, że jest nieprawdopodobne, żeby gotowe białka mogły powstać w tzw. bulionie pierwotnym (hipotetycznym praoceanicznej mieszaninie aminokwasów i innych organicznych monomerów), zaproponowali więc inne hipotezy, np. ‚Świata RNA’. O tych innych hipotezach i ich nieprzystawaniu do rzeczywistości napisałem tutaj: https://bioslawek.files.wordpress.com/2012/02/na-bezrybiu-i-rak-ryba.pdf Tyle na temat białek, czyli proteomu (kompletnej liczby białek ) w hipotetycznym pierwszym organizmie. Pamiętajmy jednak, że białka nie biorą się znikąd i nawet, jakby powstały przypadkowo jakimś cudem, to aby taki przypadkowy organizm mógł się rozmnażać, to potrzebuje DNA i RNA (jak i takich procesów, jak replikacja DNA, transkrypcja i translacja). Jak wiemy DNA składa się z trzech zasad azotowych,bardziej szczegółowo mówiąc z nukleotydów,; A, C, G, T. Trzy zasady azotowe (tzw. kodon) kodują jeden aminokwas np.; A, C, T. A, więc żeby zakodować białko zbudowane z 200 aminokwasów potrzeba 600 nukleotydów! Uczeni przeprowadzili eksperymenty, które miały na celu zredukowanie genomu bakterii do jak najmniejszej liczby nukleotydów i jak się okazało takie zredukowane życie minimalne i tak jest bardzo złożone. Udało się zredukować genom pewnej bakterii do około 600 000 nukleotydów i jak dotąd nikt nie zszedł poniżej tej granicy! Poniżej wklejam sekwencje genetyczną złożoną z 2000 nukleotydów. Taka ilość DNA może zakodować około trzech białek złożonych z 200 aminokwasów! Przy rozważaniu o początkach życia należy też pamiętać, że białka przestają być stabilne, gdy ilość tworzących je aminokwasów spada poniżej 50. Natomiast, żeby zachować przeróżne zdolności katalityczne, umożliwiające życie minimalne, przeciętna ilość cegiełek , z których zbudowane są białka, to 300 aminokwasów. To oczywiście i tak bardzo optymistyczne założenie, ponieważ niektóre białka biorące udział w replikacji DNA, transkrypcji, czy budujące rybosomy, na których odbywa się synteza białek, muszą się składać z o wiele większej liczby aminokwasów. I nikt jeszcze nie wymyślił, jakby można było je uprościć. Oto zapis sekwencji genetycznej, w której skład wchodzi 200 nukleotydów. Sekwencja nie jest dosłownym zapisem jakiejś sekwencji genetycznej, bo i nie ma takiej potrzeby, tylko sekwencją poglądowo – modelową, na potrzeby tutejszej dyskusji. Model ten nie ma na celu poznawania sekwencji DNA jakiegoś konkretnego organizmu, tylko ma dać pojęcie o ogromnej złożoności takich sekwencji, jak i całego genomu minimalnego. ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT (…..) Czy to jest duża sekwencja? Jeżeli uważacie, że tak, to pomnóżcie liczbę zasad azotowych, które ją budują przez 300. 300 x 2000 = 600 000 par zasad. , bo tyle wynosi genom minimalny! Teraz proszę się zastanowić, w jaki sposób przypadkowo miałaby szansę powstać taka informacja, w dodatku dopasowana do możliwości zakodowania białek, które rzekomo powstały wcześniej. Tak prawdę mówiąc białka, jak i DNA oraz RNA musiałyby powstać równocześnie. Przypomina się tutaj stary dylemat; „co było wcześniej kura czy jajo?” ( DNA, RNA czy białka?). No i znowu proszę sobie wyobrazić maszynę do losowania, a w niej 600 000 białych kulek, 600 000 czerwonych kulek, 600 000 zielonych kulek i 600 000 niebieskich kulek wyobrażających cztery zasady azotowe (A, T, C i G), a następnie porządnie je wymieszać (co ma obrazować praoceaniczny racemat). Jakie jest prawdopodobieństwo, że podczas losowania wylosuje się 600 000 kulek we właściwych kolorach i we właściwej kolejności? Sprawa jest jeszcze bardziej skomplikowana, ponieważ w hipotetycznym praoceanie musiałby powstać racemat (mieszanina) złożony z aminokwasów, nukleotydów, innych monomerów oraz całej gamy substancji nieużytecznych, podczas ewentualnej samosyntezy życia. Czy jeszcze ktoś chce postulować możliwość/ prawdopodobieństwo samorzutnego powstania życia? A teraz zaprezentuję, jak wygląda objętościowo cała informacja zawarta w genomie minimalnym, która wynosi około 600 000 pz (par zasad). Proszę też pamiętać, że powinienem też pokazać, jak wyglądają białka, które powstają na bazie tej informacji, to znaczy cały proteom (produkty około 500 genów). Proszę się zastanowić czy tak ogromna informacja mogła się samoistnie wyłonić w bulionie pierwotnym (w praoceanie)? ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT ACGTAACCGTGCTACGTCGT
  2. ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGT

  3. ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGT

  4. CGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGT

  5. ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTCGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGT

  6. ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTCCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGT

  7. ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGT

  8. ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGT

  9. ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGT

  10. ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGT

  11. ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGT

  12. ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
    ACGTAACCGTGCTACGTCGT

Skomentuj

Please log in using one of these methods to post your comment:

Logo WordPress.com

Komentujesz korzystając z konta WordPress.com. Log Out / Zmień )

Zdjęcie z Twittera

Komentujesz korzystając z konta Twitter. Log Out / Zmień )

Facebook photo

Komentujesz korzystając z konta Facebook. Log Out / Zmień )

Google+ photo

Komentujesz korzystając z konta Google+. Log Out / Zmień )

Connecting to %s